Re: Cashewz apology

hudra wrote:
Ask vippy to make an appeal like this

If only Vippy could write english lmfao

hudra wrote:
Ask vippy to make an appeal like this

I wish Vippy and overd0z could write a single sentence in english.

GATCAATGAGGTGGA CACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGATGGGGTTCACCTCTAATTCTAAGAGGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTATCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAA TACGCATGTTTAATAGTACAGTATGGTGACTATA GTCAACAATAATTTATTGTACATTTTTAAATAG

Just doxxed your genetic sentence

Impudent wrote:
Lets really see if ralsei is furry or he is capping capturing the genome sequence present in the strand of hair will be enough  😎

Col Mo3 Se4 Cr7 F13 Mn13 114 Cu76 Zn2,110 Fe2,680 Si38,600 Mg40,000 C1127,000 K177,000 Na183,000 $206,000 P1,020,000 Ca1,500,000 N6,430,000 C85,700,000 0132,000,000 H375,000,000.

xev wrote:
"grow up" coming from you again xDDD, your dumbass literally said this server was shit and yet you made countless accounts to evade and lied about your personality, "acklkuitalllly I'm patchy cousin" hypocrite retard, and yes big respect from the samp community gg you've finally done something with your sad life lmao, love how you're proud of it XDDDD but then again what else can be expected from a low life like you. don't talk shit under someone's post when your past is a lot worse.

keep on sucking those wtls dick dumbass.

you know you can't say anything else asshole stupid cryhard, I really didn't even read your reply cuz I'm sure they are filled with your nonsense behave asshole. fuck off from commenting anymore, you are the one who barked first, so I'll end. that's what always happened here, players always start to provoke then I get toxic and tell some truths and get banned lmao

why people here are blind and an asshole? literally everytime I post something truth and someone starts commenting and provoke a fight lol. Your in-game and forum behave tells that how pathetic you are irl. stop living in this game

now all u can do is give me a -1 disrespect because you get offended for the truth. That's how I got 9k disrespect on one of my accounts lmfao. I don't care any of my haters. You hate me and will hate me forever, keep hating because you hate your life so u play samp 24/7 and make crews like "Shah" and think you're so respectful captain which is totally a lie

xev wrote:
"grow up" coming from you again xDDD, your dumbass literally said this server was shit and yet you made countless accounts to evade and lied about your personality, "acklkuitalllly I'm patchy cousin" hypocrite retard, and yes big respect from the samp community gg you've finally done something with your sad life lmao, love how you're proud of it XDDDD but then again what else can be expected from a low life like you. don't talk shit under someone's post when your past is a lot worse.

keep on sucking those wtls dick dumbass.

you know you can't say anything else asshole stupid cry hard, I didn't even read your reply cuz I'm sure they are filled with your nonsense behave asshole. fuck off from commenting anymore, You are the one who barked first, so I'll end. that's what always happened here, players always start to provoke then I get toxic and tell some truths and get banned lmao

why are people here blind and an asshole? everytime I post something true and someone starts commenting and provoking a fight lol. Your in-game and forum behavior tells that how pathetic you are irl. stop living in this game

now all u can do is give me a -1 disrespect because you get offended by the truth. That's how I got 9k disrespect on one of my accounts lmfao. I don't care about any of my haters. You hate me and will hate me forever, keep hating because you hate your life so u play Samp 24/7 and make crews like "Shah" and think you're so respectful captain which is a lie

s1mple wrote:

why did you even leave the staff position? only to post a fucking reaction of an old guy eating and farting? only people like you are better stay in the position, but all good people just left this server ffs. Now most of the players are just cryhards. Whenever these assholes kill someone they bark "ez" like they passed their brain test in 1st grade


People like this xev won't leave this server because they have nothing else to play. their PC cant even handle the windows properly. shame on you (people like xev) guys.

Literally, as an Indian, I loved how raza.ali was... But now what? Another guy from his country named xev is acting the same as a terrorist. Good people just leave. And barking players keep hating.

Veteran950 wrote:
I don't give a fuck if anybody cares about me in here because I've got enough respect from some other bigger community, unlike you.

Imagine claiming respect on a 2005 (PC release) game. What a pathetic little crying bitch.

punisher wrote:
Nah bro watch out he has respect in others community i wouldnt mess with him.

I got scared bro ngl he got -9k disrespect 😬😬

Damien_Scott wrote:
Hello Lexie dont talk shit about Shah

Alhamdulillah